Trimadap is a small tool to trim adapter sequences from Illumina data. It
performs SSE2-SW between each read and each adapter sequence and identifies
adapter sequences with a few heuristic rules which can be found in the
ta_trim1() function in trimadap.c. The default adapters it uses are
included in illumina.txt. These are typical Illumina adapters from
paired-end sequencing.
Trimadap is designed as an on-the-fly stream filter. It is very fast. In the multi-threading mode, it is as fast as reading through a gzip-compressed FASTQ file. On the other hand, trimadap is very conservative. It is not good in terms of accuracy as of now. I will probably fine tune the heuristic rules in future. This should not be hard in principle, but it takes development time.
Parameters
| Parameter | Type | Description | Default/Note |
|---|---|---|---|
-3 |
STR | 3'-end adapter | DNBSEQ Forward filter |
-5 |
STR | 5'-end adapter | DNBSEQ Reverse filter |
-l |
INT | min length | 8 |
-s |
INT | min score | 15 |
-t |
INT | trim down masked part (Xs) | don't trim |
-d |
FLOAT | max difference | 0.150 |
-r |
INT | min read length (w/ trimmed bases counted out) to output | 35 |
-p |
INT | number of trimmer threads | 1 |
-m |
CHAR | masker character (X or N) | X |
-q |
perform basic fq qc | ||
-h |
print help message | ||
-v |
print version number |
Examples
- process DNBSEQ SE reads data
trimadap \
-3 AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA \
-l 5 -t 50 -r 35 a.fq > a_masked.fq
- process DNBSEQ PE reads data and mask adaptor sequences as Ns
trimadap \
-3 AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA \
-5 AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG \
-l 5 -t 50 -r 35 -m N a.fq > a_masked.fq