saphetor / varsome-api-client-python

Example client programs for Saphetor's VarSome annotation API

Home Page:https://api.varsome.com

Geek Repo:Geek Repo

Github PK Tool:Github PK Tool

VarSome API Client

A basic API client implementation for api.varsome.com

This tool contains examples for the Varsome API usage. It can be used against the production server (api.varsome.com), the staging server (staging-api.varsome.com) or the stable api server (stable-api.varsome.com)

Staging-api environment

The staging-api.varsome.com environment is a free usage test environment for subscribers. It is the perfect environment for evaluating the performance of the API. It is updated on an adhoc basis at our discretion, either together with live or possibly ahead of live in order to test upcoming new features.

It contains a substantial, but partial, data-set. Additionally it is throttled and is limited in the types of queries you can run. For example, it allows for only a limited number of samples and a limited size of data.

Please note: For this reason API queries performed against the staging environment within the client may not always run correctly or may produce different results to the production environment.

Python versions

Requires at least Python 3.3, you can download the latest version from www.python.org

Installation

We suggest that you create a python virtual environment instead of globally installing the library.

There are several ways to create a virtual environment, but you can refer to pip installation and virtualenv installation to first install these 2 tools if you don't have them already installed via a package manager (Linux) or HomeBrew (MacOS), etc. Remember to use "sudo -H" when installing on Mac.

To create a virtual environment, you can follow the user guide or simply run:

virtualenv -p path_to/python3 venv_dir_name

Activate the virtual environment:

source venv_dir_name/bin/activate

Finally, to use the client, either download or clone the repository from github and place the varsome_api folder inside your project's directory, or run:

pip install https://github.com/saphetor/varsome-api-client-python/archive/master.zip

The client will be installed within your virtual environment. Also, 2 scripts called varsome_api_run.py and varsome_api_annotate_vcf.py will be available within your virtual environment's $PATH.

Using the scripts to directly annotate a list of variants or a VCF file

Annotating a variant or list of variants

Try the following query to annotate a single variant:

varsome_api_run.py -g hg19 -k api_key -q 'chr7-140453136-A-T' -p add-all-data=1

The script should complete without errors and display aproximately 6,700 lines of data from dann, dbnsfp, ensembl_transcripts, gerp, gnomad_exomes, gnomad_exomes_coverage, icgc_somatic, ncbi_clinvar2, pub_med_articles, refseq_transcripts, sanger_cosmic_public, uniprot_variants, wustl_civic etc. The script can also accept a text file with variants (one per line) and an optional output file to store the annotations in. We suggest that you don't use this script for a large number of variants, but use the client within your code instead.

varsome_api_run.py -g hg19 -k api_key -i variants.txt -o annotations.txt -p add-all-data=1

The command above will read variants from variants.txt and dump the annotations to annotations.txt. For any number of variants you will need to register for an API key.

Example to query CNVs

varsome_api_run.py -g hg19 -k api-key -q 'cnv/chr2:83300000:106000000:dup' -p add-all-data=1

The query parameter specifies the CNV's details such as chromosome, start and end positions, and CNV type (deletion or duplication). In this example we have chr2, 83300000 and 106000000 and dup accordingly (for deletion use del).

Example to query Genes

varsome_api_run.py -g hg19 -k api-key -q 'gene/EGFR' -p add-all-data=1

The single gene lookup endpoint allows users to retrieve gene data associated with a specific gene symbol, specifying optional parameters such as reference genome and source databases.

Example to query Transcripts

Try the following query to retrieve transcript-related data:

varsome_api_run.py -g hg19 -k api-key -q 'transcript/NM_001276760' -p add-all-data=1

Example to query Single Reads

Try the following to retrieve data relevant to a single read:

varsome_api_run.py -g hg19 -k api-key -q 'single-read/AGTCCRAGTTGTAAATGGTACACTCGGCGTAAGCCTGAAAAGATAAAATCAAAGATGTAAAGGTGAGCACAGTCTAAGTTCTCTCTGAAGTGTCAATGGGAATGCAGATTGGATTAAATAAATGCTGCCCAAGTGCATACTCAAAGAGGC' -p add-all-data=1

Annotating a VCF file

To annotate a VCF file, use:

varsome_api_annotate_vcf.py -g hg19 -k api_key -i input.vcf -o annotated_vcf.vcf -p add-all-data=1

Notice, however, that not all available annotations will be present in the annotated_vcf.vcf file. Only a subset of the returned annotations will be available when running this script. See the "Using the client in your code" section below for how to annotate a VCF file with the annotations that are of interest to you.

Warning: varsome_api_annotate_vcf.py can only deal with:

  • SNPs
  • small indels (up to 200bp)

If you want to use this script please remove any variant from your VCF that does not meet the above criteria.

Using the client in your code

Using the API client is quite straightforward. Just install the API client package and use the following in your code:

from varsome_api.client import VarSomeAPIClient
# API key is not required for single variant lookups
api_key = 'Your token'
api = VarSomeAPIClient(api_key, api_url="https://stable-api.varsome.com")
# fetch information about a variant into a dictionary
result = api.lookup('chr7-140453136-A-T', params={'add-source-databases': 'gnomad-exomes,refseq-transcripts'}, ref_genome='hg19')
# access results e.g. the transcripts of the variant
transcripts = result['refseq_transcripts']
# fetch information for multiple variants
variants = ['chr19:20082943:1:G','chr22:39777823::CAA']
# Results will be an array of dictionaries. An API key will be required for this request
results = api.batch_lookup(variants, params={'add-source-databases': 'gnomad-exomes,gnomad-genomes'}, ref_genome='hg19')
# look at the python doc for batch_lookup method for additional parameters

If errors occur while using the client, an exception will be thrown. You may wish to catch this exception and proceed with your own code logic:

from varsome_api.client import VarSomeAPIClient, VarSomeAPIException
api_key = 'Your token'
api = VarSomeAPIClient(api_key)
try:
   result = api.lookup('chr19:20082943:1:G', ref_genome='hg64')
except VarSomeAPIException as e:
    # proceed with your code flow e.g.
    print(e) # 404 (invalid reference genome)

To view available request parameters (used by the params method parameter), refer to an example at api.varsome.com.

To understand how annotation properties are included in the JSON response, please refer to the relevant schema.

JSON response wrapper

If you don't want to read through each attribute in the JSON response, you can wrap the result into a Python JSON model:

from varsome_api.client import VarSomeAPIClient
from varsome_api.models.variant import AnnotatedVariant
# API key is not required for single variant lookups
api_key = 'Your token'
api = VarSomeAPIClient(api_key)
# fetch information about a variant into a dictionary
result = api.lookup('chr7-140453136-A-T', params={'add-source-databases': 'gnomad-exomes,refseq-transcripts'}, ref_genome='hg19')
annotated_variant = AnnotatedVariant(**result)

You now have access to a set of shortcut attributes (these will be updated over time in the code base):

annotated_variant.chromosome
annotated_variant.alt
annotated_variant.genes # directly get the genes related to the variant
annotated_variant.gnomad_exomes_af # etc

Or you may access other inner properties of other available properties:

# get gnomad exomes allele number
allele_number = [gnomad_exome.an for gnomad_exome in annotated_variant.gnomad_exomes]

JSON model-type objects that contain a version property, like annotated_variant.gnomad_exomes, are always returned as lists of objects. This is because the API has the ability to return multiple versions of annotation databases (although this is not currently publicly available). For consistency, therefore, these are always lists, though it is safe to assume that they will only include a single item. So it is safe to rewrite as:

try:
    allele_number = [gnomad_exome.an for gnomad_exome in annotated_variant.gnomad_exomes][0]
except IndexError:
    pass # no gnomad exomes annotation for the variant

Complete examples to try yourself

Below there are examples utilizing cancer, tissue type and phenotypes, diseases options.

from varsome_api.client import VarSomeAPIClient, VarSomeAPIException
from varsome_api.models.variant import AnnotatedVariant


api_key = 'Your token'
api = VarSomeAPIClient(api_key, api_url="https://stable-api.varsome.com")

try:
    result = api.lookup(
        "chr22-29091857-G-",
        params={
            "add-source-databases": "gnomad-exomes,refseq-transcripts",
            "annotation-mode": "somatic",
            "cancer-type": "Prostate Adenocarcinoma",
            "tissue-type": "Prostate",
        },
        ref_genome="hg19",
    )
except VarSomeAPIException as e:
    print(e)

annotated_variant = AnnotatedVariant(**result)
print(
    annotated_variant.chromosome,
    annotated_variant.genes,
    annotated_variant.gnomad_exomes_af,
)
try:
    allele_number = [
        gnomad_exome.an for gnomad_exome in annotated_variant.gnomad_exomes
    ]
except IndexError:
    pass
print(allele_number)
from varsome_api.client import VarSomeAPIClient, VarSomeAPIException
from varsome_api.models.variant import AnnotatedVariant

api_key = 'Your token'
api = VarSomeAPIClient(api_key, api_url="https://stable-api.varsome.com")

try:
    result = api.lookup(
        "15:68500735:C:T",
        params={
            "add-source-databases": "gnomad-exomes,refseq-transcripts",
            "annotation-mode": "germline",
            "patient-phenotypes": "Progressive Visual Loss",
            "diseases": "Neuronal Ceroid Lipofuscinosis 4A",
        },
        ref_genome="hg19",
    )
except VarSomeAPIException as e:
    print(e)

annotated_variant = AnnotatedVariant(**result)
print(
    annotated_variant.chromosome,
    annotated_variant.alt,
    annotated_variant.genes,
    annotated_variant.gnomad_exomes_af,
)
try:
    allele_number = [
        gnomad_exome.an for gnomad_exome in annotated_variant.gnomad_exomes
    ]
except IndexError:
    pass
print(allele_number)

Annotating a VCF using the client

To annotate a VCF you can base your code on the VCFAnnotator object. This provides a basic implementation that will annotate a VCF file using a set of the available annotations. It uses PyVCF to read and write to VCF files.

from varsome_api.vcf import VCFAnnotator
api_key = 'Your token'
vcf_annotator = VCFAnnotator(api_key=api_key, ref_genome='hg19', get_parameters={'add-all-data': 1, 'expand-pubmed-articles': 0})
vcf_file = 'input.vcf'
output_vcf_file = 'annotated.vcf'
vcf_annotator.annotate(vcf_file, output_vcf_file)

To annotate the VCF file with the annotations that you are interested in, you need only override 2 methods (annotate_record and add_vcf_header_info) in the VCFAnnotator class:

from varsome_api.vcf import VCFAnnotator
from vcf.parser import _Info, _encode_type
class MyVCFAnnotator(VCFAnnotator):


    def annotate_record(self, record, variant_result, original_variant):
        """
        :param record: vcf record object
        :param variant_result: AnnotatedVariant object
        :param original_variant: The variant that was looked up
        :return: annotated record object
        """
        record.INFO["gnomad_exomes_AN"] = variant_result.gnomad_exomes_an
        # if you wish to also include the default annotations
        # return super().annotate_record(record, variant_result, original_variant)
        return record

    def add_vcf_header_info(self, vcf_template):
        """
        Adds vcf INFO headers for the annotated values provided
        :param vcf_template: vcf reader object
        :return:
        """
        vcf_template.infos["gnomad_exomes_AN"] = _Info(
            "gnomad_exomes_AN",
            1,
            "Integer",
            "GnomAD exomes allele number value",
            None,
            None,
            _encode_type("Integer"),
        )
        # if you wish to also include the default headers
        # super().add_vcf_header_info(vcf_template)

api_key = 'Your token'
vcf_annotator = MyVCFAnnotator(api_key=api_key, ref_genome='hg19', get_parameters={'add-all-data': 1, 'expand-pubmed-articles': 0})
vcf_file = 'input.vcf'
output_vcf_file = 'annotated.vcf'
vcf_annotator.annotate(vcf_file, output_vcf_file)

Complete examples to try yourself

Below there are examples utilizing cancer, tissue type and phenotypes, diseases options. Keep in mind that these options are subjective to your vcf file.

from varsome_api.vcf import VCFAnnotator
from vcf.parser import _Info, _encode_type


class MyVCFAnnotator(VCFAnnotator):
    def annotate_record(self, record, variant_result, original_variant):
        """
        :param record: vcf record object
        :param variant_result: AnnotatedVariant object
        :param original_variant: The variant that was looked up
        :return: annotated record object
        """
        record.INFO["gnomad_exomes_AN"] = variant_result.gnomad_exomes_an
        # if you wish to also include the default annotations
        # return super().annotate_record(record, variant_result, original_variant)
        return record

    def add_vcf_header_info(self, vcf_template):
        """
        Adds vcf INFO headers for the annotated values provided
        :param vcf_template: vcf reader object
        :return:
        """
        vcf_template.infos["gnomad_exomes_AN"] = _Info(
            "gnomad_exomes_AN",
            1,
            "Integer",
            "GnomAD exomes allele number value",
            None,
            None,
            _encode_type("Integer"),
        )
        # if you wish to also include the default headers
        # super().add_vcf_header_info(vcf_template)


api_key = 'Your token'
vcf_annotator = MyVCFAnnotator(
    api_key=api_key,
    ref_genome="hg38",
    get_parameters={
        "add-source-databases": "gnomad-exomes,refseq-transcripts",
        "expand-pubmed-articles": 0,
        "annotation-mode": "somatic",
        "cancer-type": "Prostate Adenocarcinoma",
        "tissue-type": "Prostate",
    },
)
vcf_file = "input.vcf"
output_vcf_file = "annotated.vcf"
vcf_annotator.annotate(vcf_file, output_vcf_file)
from varsome_api.vcf import VCFAnnotator
from vcf.parser import _Info, _encode_type


class MyVCFAnnotator(VCFAnnotator):
    def annotate_record(self, record, variant_result, original_variant):
        """
        :param record: vcf record object
        :param variant_result: AnnotatedVariant object
        :param original_variant: The variant that was looked up
        :return: annotated record object
        """
        record.INFO["gnomad_exomes_AN"] = variant_result.gnomad_exomes_an
        # if you wish to also include the default annotations
        # return super().annotate_record(record, variant_result, original_variant)
        return record

    def add_vcf_header_info(self, vcf_template):
        """
        Adds vcf INFO headers for the annotated values provided
        :param vcf_template: vcf reader object
        :return:
        """
        vcf_template.infos["gnomad_exomes_AN"] = _Info(
            "gnomad_exomes_AN",
            1,
            "Integer",
            "GnomAD exomes allele number value",
            None,
            None,
            _encode_type("Integer"),
        )
        # if you wish to also include the default headers
        # super().add_vcf_header_info(vcf_template)


api_key = 'Your token'
vcf_annotator = MyVCFAnnotator(
    api_key=api_key,
    ref_genome="hg19",
    get_parameters={
        "add-source-databases": "gnomad-exomes,refseq-transcripts",
        "expand-pubmed-articles": 0,
        "annotation-mode": "germline",
        "patient-phenotypes": "Progressive Visual Loss",
        "diseases": "Neuronal Ceroid Lipofuscinosis 4A",
    },
)
vcf_file = "input.vcf"
output_vcf_file = "annotated.vcf"
vcf_annotator.annotate(vcf_file, output_vcf_file)

API Documentation

See API documentation for information on how to use the API and what values the API provides as a response to lookup requests.

How to get an API key

To obtain an API key please contact us.

How to run the tests

Clone the repository, after creating a virtual environment, and run:

pip install tox
tox

To run the tests, set the VARSOME_API_KEY environment variable to your API token. Otherwise, tests will fail because the API will return a 401 (not authenticated) error. Be advised as well that running the tests will count towards your account request limit depending on the API package you are subscribed to.

About

Example client programs for Saphetor's VarSome annotation API

https://api.varsome.com

License:Apache License 2.0


Languages

Language:Python 100.0%