tbl2asn-forever returns exit code 1
zdk123 opened this issue · comments
Zachary Kurtz commented
I encountered an issue via the conda installation (bioconda recipe]. Basically, even when the code completes, tbl2asn-forever returns exits with code 1.
This effects workflows such as nf-core/bacass#17.
reproducible example adapted from the NCBI manual page:
conda create -n t2a -c bioconda
conda create -n t2a4e -c bioconda tbl2asn-forever
echo ">P74A8 [chromosome=2] [clone=ABC12345]
gatcagcccaaagcattgattaggggaacttacctgtagagggctgcagcaatggggaac
acctggctgggtcacagagtggtcaatgcactccatgacttttgggtcaggacacagaaa
gaaagagcggggaaccggggggccctacagtgatgaattatactaactgattttagaatg
>segment2
ttaaacaaacattgcatttccagaataaaccccatttagtaacgcatagtgtgcttgtat
ctcagcctcccaaagtgctgggattatagacatgagccagcgcacctggctttgttagcc
>segment3
ttttcaaataactttttgaactttgttaattttttaattgcacgttttctccttcattta
ctaattccattcaaaagtagcatcaatgagaataaattacttaggaatacatttaattaa
aaagtgctagacttgtacactgaaaattacaaagtactctggagatatattc" > test.fasta
conda activate t2a
SYSTEM="mac"
#SYSTEM="linux"
wget ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/converters/by_program/tbl2asn/${SYSTEM}.tbl2asn.gz
gunzip ${SYSTEM}.tbl2asn.gz
mv ${SYSTEM}.tbl2asn $CONDA_PREFIX/bin/tbl2asn
chmod a+x $CONDA_PREFIX/bin/tbl2asn
tbl2asn -a di -i test.fasta -C center_name -j "[tech=htgs 2] [organism=Triticum aestivum] [cultivar=Chinese Spring]" -o output_file.ss
echo $?
# 0
conda activate t2a4e
rm output_file.ss
tbl2asn -a di -i test.fasta -C center_name -j "[tech=htgs 2] [organism=Triticum aestivum] [cultivar=Chinese Spring]" -o output_file.ss
echo $?
# 1
This might be mac only
Robert A. Petit III commented
Hi @zdk123
A bit late to the party, but I've fixed this on the Bioconda side (bioconda/bioconda-recipes#24110). Will probably need to update. I'll take a look at the Prokka package to make sure no changes are needed on that end.
Let me know if it doesn't work. I've only tested it on Catalina.
Zachary Kurtz commented
Working on Mojave now too. Thanks!