tbl2asn-forever returns exit code 1

[Zachary Kurtz]

I encountered an issue via the conda installation (bioconda recipe]. Basically, even when the code completes, tbl2asn-forever returns exits with code 1.

This effects workflows such as nf-core/bacass#17.

reproducible example adapted from the NCBI manual page:

conda create -n t2a -c bioconda
conda create -n t2a4e -c bioconda tbl2asn-forever


echo ">P74A8 [chromosome=2] [clone=ABC12345]
gatcagcccaaagcattgattaggggaacttacctgtagagggctgcagcaatggggaac
acctggctgggtcacagagtggtcaatgcactccatgacttttgggtcaggacacagaaa
gaaagagcggggaaccggggggccctacagtgatgaattatactaactgattttagaatg
>segment2
ttaaacaaacattgcatttccagaataaaccccatttagtaacgcatagtgtgcttgtat
ctcagcctcccaaagtgctgggattatagacatgagccagcgcacctggctttgttagcc
>segment3
ttttcaaataactttttgaactttgttaattttttaattgcacgttttctccttcattta
ctaattccattcaaaagtagcatcaatgagaataaattacttaggaatacatttaattaa
aaagtgctagacttgtacactgaaaattacaaagtactctggagatatattc" > test.fasta


conda activate t2a
SYSTEM="mac"
#SYSTEM="linux"
wget ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/converters/by_program/tbl2asn/${SYSTEM}.tbl2asn.gz
gunzip ${SYSTEM}.tbl2asn.gz
mv ${SYSTEM}.tbl2asn $CONDA_PREFIX/bin/tbl2asn
chmod a+x $CONDA_PREFIX/bin/tbl2asn
tbl2asn -a di -i test.fasta -C center_name -j "[tech=htgs 2] [organism=Triticum aestivum] [cultivar=Chinese Spring]" -o output_file.ss
echo $?
# 0 

conda activate t2a4e
rm output_file.ss
tbl2asn -a di -i test.fasta -C center_name -j "[tech=htgs 2] [organism=Triticum aestivum] [cultivar=Chinese Spring]" -o output_file.ss
echo $?
# 1

This might be mac only

[Robert A. Petit III]

Hi @zdk123

A bit late to the party, but I've fixed this on the Bioconda side (bioconda/bioconda-recipes#24110). Will probably need to update. I'll take a look at the Prokka package to make sure no changes are needed on that end.

Let me know if it doesn't work. I've only tested it on Catalina.

[Zachary Kurtz]

Working on Mojave now too. Thanks!