Get midseq form fastq reads
usage: midseq.py [-h] [-f F] [-t T] [-o OUTPUT] [-of OUTPUTFASTA]
[Fastq files [Fastq files ...]]
Get the internal sequence between 5' and 3' boundary sequence from fastq file.
E.g., get string "ATLAS" from "GGGATLASAAA" with -f "GGG" and -t "AAA".
positional arguments:
Fastq files HTS reads in fastq format (not in .gz format). Support
muti-fastq-files.
optional arguments:
-h, --help show this help message and exit
-f F The 5' sequence. Default is: CCGGCGACGTTGGGTCAACT
-t T The 3' sequence. Default is: TGTCCTCTTCCTCTTTAGCG
-o OUTPUT, --output OUTPUT
The output file name.
-of OUTPUTFASTA, --outputfasta OUTPUTFASTA
The output fasta name. The default is not to output
this file unless assigned its file name.