This is a modified version, contains function of length limitation of adapter trimming. For more detailed information, please refer to fastp. And a prebuiled binary file based on linux system is under centos directory.
-
add --min_trim_length option, which is used to limit the length of adapter trimming, default 10.
-
the origin --overlap_diff_limit option is unapplicable, we revised the code and used it to selection the overlap result.
-
parse_fastp.py is used to summary the fastp's json file and plot.
For general usage:
## only overlap used for trimming
./centos/fastp -i testdata/R1.fq.gz \
-I testdata/R2.fq.gz \
-o testdata/R1.clean.fq.gz \
-O testdata/R2.clean.fq.gz \
--qualified_quality_phred 5 \
--unqualified_percent_limit 50 \
--n_base_limit 15 \
--overlap_len_require 30 \
--overlap_diff_limit 1 \
--min_trim_length 10 \
--overlap_diff_percent_limit 10 \
--length_limit 150 \
--disable_trim_poly_g \
--json testdata/test_fastp.json \
--html testdata/test_fastp.html \
--report_title fastp_test
## overlap and adapter sequence trimming
./centos/fastp -i testdata/R1.fq.gz \
-I testdata/R2.fq.gz \
-o testdata/R1.clean.fq.gz \
-O testdata/R2.clean.fq.gz \
--qualified_quality_phred 5 \
--unqualified_percent_limit 50 \
--n_base_limit 15 \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
--overlap_len_require 30 \
--overlap_diff_limit 1 \
--min_trim_length 10 \
--overlap_diff_percent_limit 10 \
--length_limit 150 \
--disable_trim_poly_g \
--json testdata/test_fastp.json \
--html testdata/test_fastp.html \
--report_title fastp_test
Parse fastp output
optional arguments:
-h, --help show this help message and exit
--fastp-json FASTP_JSON, -i FASTP_JSON
Fastp json file
--outdir OUTDIR, -o OUTDIR
Output directory
--samplename SAMPLENAME, -s SAMPLENAME
sample name
Example:
python parse_fastp.py -i testdata/test_fastp.json -o testdata -s test