tomtheisen / crossy

mRNA analytics

1. Installation
2. Overview
3. Examples
4. References
5. Roadmap

Installation

pip install crossy

Overview

The goal of crossy is to provide RNA stability tools for researchers and scientists in a well-tested Python package which is easy to install and use.

The name crossy is a reference to RNA secondary structure which sometimes forms a "cross" shape.

Examples

Create mRNA object and calculate stability.

from crossy import MRNA
from crossy.analyze import monte_carlo_strategy, apply_substitutions

# Generate MRNA object
mrna = MRNA.from_sequence("CCTACAGCAACTTTAGATGTTACTGAAGTC")
stability = mrna.total_stability  # 0.466...

Get and apply substitutions to target a 0.5 increase in stability.

# Get and apply substitutions
substitutions = monte_carlo_strategy(mrna.get_candidate_substitutions(), 0.5)
new_mrna = apply_substitutions(mrna, substitutions)

new_mrna.total_stability  # 0.964 ~ 0.466 + 0.5

References

The mRNA stability calculation is primarily based on work in Saccharomyces cerevisiae from Coller lab from 2015: Codon Optimality Is a Major Determinant of mRNA Stability

The work showed a quantitative relationship between codon prevalance and mRNA half life in living cells.

Roadmap

• Recent reviews discuss the relationship between codon prevalence and mRNA stability, translation rate, and correct folding: link.

  • The relationship between these effects and tRNA prevalance (tRNA Adaptive Index, TAI), which is known for several species, is discussed.

• Predictive RNA secondary structure models are now (being developed)[http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi].

• RNA stability in storage is the subject of a recent (Kaggle competition)[https://www.kaggle.com/c/stanford-covid-vaccine/data].