tcrimi / myxogast

Myxogast

A graph aligner in Rust

Myxogast will be a network aligner based on the classic dynamic programming algorithms, and using a novel JSON reference sequence format supporting:

• wildcards ('N' and '*')
• branch points
• HMM-style probabilities

For example, this is a valid graph-JSON reference:

    [{"id":    "domain_1",
     "seq":    "*ATGCATGC"},
     {"id":    "domain_2",
      "branch": [{"id":   "A",
                  "seq":  "GGCGGC"},
                 {"id":   "B",
                  "seq":  "TTATAG"}]
     },
     {"id":    "domain_3",
      "dist":  [{"A": 0.5, "T": 0.5}, {"A": 0.1, "T": 0.1, "G": 0.8}]},
     "TATTATA",

     {"__META__": {"version": 0.1,
                   "gap-penalty": -1}}]

Broadly, there are 3 node types: sequence fragments, branches, and probability distributions. The simplest valid graph-JSON reference sequence is a simple JSON string, eg "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTG", and represents a "fragment" node without an id. Functionally, this is equivalent to {"id": "BA000007.2", "seq": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTG"}.

Status

Currently, basic Needleman-Wunsch alignment works, basic graphs are parsed correctly, and some basic form of graph alignment seems to work.

Internals

Reference sequence graphs are represented like so:

enum SeqNode {
    Nil,

    Frag {
        id: u32,
        val: Sequence,
        llocal: bool,
        rlocal: bool,

        next: Rc<SeqNode>
    },

    //Dist { id: u32, scores: ProbMatr },

    Branch {
        id: u32,
        llocal: bool,
        rlocal: bool,
        members: Vec<SeqNode>
    }
}

struct SeqGraph {
    tree: SeqNode,
    names: BTreeMap<u32, String>
}

Nodes are identified by a unique u32 integer. Names from the "id" field in the graph-JSON input are stored in a BTreeMap, and not with the nodes, because (1) names are optional, and (2) not guaranteed to be unique.

TODO

• set Frag llocal/rlocal fields based on splats
• add PARAMS block to JSON format
• enforce short-circuiting of alignment (eg, max 3 indels)
• HMM/Viterbi alignmed
• modify Sequence to bit-pack bases (ATGCN- -> 3 bits, or 10 bases per u32) (?? is this worth the effort?)