louiejtaylor / pyviko

A web interface & Python tool to design knockouts in viruses with overlapping genes.

pyViKO

A Python tool to generate viral knockouts.

What is Pyviko?

Pyviko stands for Python Viral KnockOuts. Pyviko is a tool for designing molecular cloning protocols in complex viruses or other organisms with overlapping genes. Check out Taylor LJ, Strebel K. Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes. BMC Microbiol. 2017 Jan 7;17(1):12. for more information.

What is an “overprinted gene”?

An overprinted gene is defined as the extension of one gene's open reading frame into the reading frame of a second gene. A single DNA sequence can code for multiple proteins in different reading frames or by reading in different directions. For more information, see the Wikipedia article on reading frames or this (open access) paper on origins of overprinted genes.

How do I install Pyviko?

If you have pip:

pip install pyviko

Otherwise, you can install it directly using setup.py:

python `setup.py` install

(What is setup.py?)

Can I use Pyviko without installing anything?

Yes, the basic workflow is available as a web-based JavaScript user interface. Also check out the Quick-start guide for more information on using the web interface.

How do I use Pyviko?

Here's a simple example in an interpreter:

>>> from pyviko import mutation
>>> m = mutation.Mutant(        "ATGCATCCCTCAAGTGACTAA")
>>> m.setOverGene(overSeq = "ATGTATGCATCCCTCAAGTGA")
>>> m.findMutants()
[(0, 'ACG'), (3, 'TAA'), (3, 'TGA')]

There are more sample scripts in the examples folder. Also check out the Pyviko documentation.