A pipeline for processing raw single-cell RNA-seq generated by the Drop-seq protocol.
To run this pipeline, you'll need Nextflow installed on your machine. Install it with the following command:
curl -s https://get.nextflow.io | bash
With Nextflow installed and accessible in your PATH, the pipeline can be run with the following command:
nextflow run gates-mri-bioinformatics/drop-seq-tools-pipeline -user <Github username>
You'll be prompted for your Github password. After providing it, Nextflow will automatically pull scripts from this repository
and run them in the environment specified by the configuration file nextflow.config (see more details on this file below). There's no need to clone this repository.
Pipeline parameters can be set in a nextflow.config file in the directory from which nextflow is launched:
params.output_directory = "/path/to/my/results"
params.fastq_directory = "/path/to/my/reads"
params.reference_fasta = "/path/to/my/sequence"
params.reference_gtf = "/path/to/my/annotations"
params.star_index = "/path/to/my/index
Alternatively, the required parameters can also be provided via the command line:
nextflow run gates-mri-bioinformatics/drop-seq-tools-pipeline -user liameabbott \
--output-directory /path/to/my/results \
--fastq-directory /path/to/my/reads \
--reference-fasta /path/to/my/sequence \
--reference-gtf /path/to/my/annotations
--star-index /path/to/my/index
Note the inclusion of the params. prefix in the config file version, and the use of underscores (_) in the config file version versus hyphens (-) in the command-line version.
--output-directory:
Path to a directory to write pipeline output files.
--fastq-directory:
Path to a directory with paired FASTQ files containing raw reads.
--reference-fasta:
Path to a FASTA file containing a reference genome sequence.
--reference-gtf:
Path to a GTF file containing annotations for the reference genome sequence.
--star-index:
Path to a `STAR` index created from the `--reference-fasta` genome sequence.
--mt-sequence (default "null"):
The string used to specify mitochondrial contig in the reference files.
--cell-barcode-base-range (default "1-12"):
The range of bases in the barcode read used to define the cell barcode.
--umi-barcode-base-range (default "13-20"):
The range of bases in the barcode read used to define the UMI barcode.
--barcoded-read (default "1"):
The number of the barcode read in the read pair (either "1" or "2").
--barcode-min-base-quality (default "10"):
The minimum acceptable base quality in the barcodes.
--barcode-n-bases-below-min-quality (default "1"):
The number of bases in the barcode allowed to be below the quality threshold before the read is discarded.
--trim-starting-sequence (default "AAGCAGTGGTATCAACGCAGAGTGAATGGG"):
The adapter sequence to look for at the beginning of the read.
--trim-starting-n-bases (default "5"):
The number of bases at the beginning of the read that must match "--trim-starting-sequence" before trimming occurs.
--trim-starting-n-mismatches (default "0"):
The number of mismatches allowed in the starting sequence before determining that the read should be trimmed.
--trim-polyA-adapter (default "~XM~XCGTACTCTGCGTTGATACCACTGCTT"):
The adapter sequence. "^XM" references the value of the "XM" tag applied in the barcode tagging stage. "~XM" references the reverse complement of the tag.
--star-n-cores (default "1"):
The number of CPU cores to use in `STAR` alignment.
--star-limit-out-sj-collapsed (default "5000000"):
STAR parameter - maximum number of collapsed splice junctions.
--repair-min-umis-per-cell (default "20"):
The minimum number of UMIs to consider a cell barcode for collapsing during barcode repair steps.
With Docker installed on your machine, you can execute the pipeline in a containerized environment with all required dependencies installed:
nextflow run gates-mri-bioinformatics/drop-seq-tools-pipeline -user <Github username> -profile docker