anjahess / pysulfite

A collection of simple scripts to facilitate the setup of everyday epigenetics experiments and to handle genomic methylation data

pysulfite

A collection of simple scripts to handle genomic methylation data.

1. Installation

pysulfite is purely based on Python > 3.

sudo apt-get update
sudo apt-get install python3.6

2. Example: Find the genomc binding site of a meth primer (e.g. for qMSP)

Step 1: Enter the directory of your fasta files

mother_dir = "/home/yourname/fastas/"

Step 2: Modify the "fasta dict" in order to specify which gene/region you're provide the fasta for

Let's assume you know which gene the primers are targetting: simply provide the entire genomic region of interest as a fasta.

fasta_dict = {
    "ACTB":f"{mother_dir}Homo_sapiens_ACTB_sequence.fa",
    "SOX2": f"{mother_dir}Homo_sapiens_SOX2_sequence.fa",
    }

Step 3: Enter the primers for methylated bisulfite converted PCR product (preserved CG):

Important note: You need to reverse complement the reverse primer. These sequences are fully made up and serve as an example only. Order: fwd, rev (but doesn't affect the result yet)

primer_dict = {
    "ACTB":["TTTTCCCCTTTTTCCCC", "ATGCTTATTATATATTAT"],
    "SOX2":["TTTTCCCCAAAACCCC", "ATGCTTATAAAATATTAT"],
  }

Step 4: Run the script

In your terminal:

python3 pysulfite/find_where_qMSP_primer_binds.py

In your IDE: click run

Step 5: View result!

pysulfite will tell you the original DNA sequence your primer binds, but only if your primer sequence is actually targeting in the fasta you provided.

Example output:

    -------- ACTB
    --- Forward primer
    Found mPrimer in bisulfite-converted sequence at pos: 32278
    mPrimer: GGGGTTTTATTGCGGAGTGC
    origin.: GGGGCCCCACTGCGGAGTGC <- Please reverse compl if this is rev primer
    uPrimer: GGGGTTTTATTGTGGAGTGT

3. Authors

• Anja Hess - Initial work

4. Citing

Please cite this github repo whenever used in your work.

5. License

This project is licensed under the GPL3 License - see the LICENSE file for details.