bio-polyploid-tools
Introduction
This tools are designed to deal with polyploid wheat. The first tool is to design KASP primers, making them as specific as possible.
Installation
gem install bio-polyploid-tools
You need to have in your $PATH
the following programs:
The code was originally developed on ruby 2.1, 2.3 and 2.5. It may work on older version. However, it is only actively tested in currently supported ruby versions:
- 2.1.10
- 2.2.5
- 2.3.5
- 2.4.2
- 2.5.0
PolyMarker
To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.
polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder
The snp_list
file must follow the convention ID,Chromosome,SEQUENCE
with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv
If you want to use the web interface, visit the PolyMarker webservice at TGAC
The available command line arguments are:
Usage: polymarker.rb [options]
-c, --contigs FILE File with contigs to use as database
-m, --marker_list FILE File with the list of markers to search from
-g, --genomes_count INT Number of genomes (default 3, for hexaploid)
-s, --snp_list FILE File with the list of snps to search from, requires --reference to get the sequence using a position
-t, --mutant_list FILE File with the list of positions with mutation and the mutation line.
requires --reference to get the sequence using a position
-r, --reference FILE Fasta file with the sequence for the markers (to complement --snp_list)
-o, --output FOLDER Output folder
-e, --exonerate_model MODEL Model to be used in exonerate to search for the contigs
-i, --min_identity INT Minimum identity to consider a hit (default 90)
-a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
Function to decide the chromome arm
-p, --primer_3_preferences FILE file with preferences to be sent to primer3
-v, --variation_free_region INT If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
-x, --extract_found_contigs If present, save in a separate file the contigs with matches. Useful to debug.
-P, --primers_to_order If present, saves a file named primers_to_order which contains the KASP tails
Input formats
The following formats are used to define the marker sequences:
Marker list
If the option --marker_list FILE
is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):
- snp_name The ID of the marker. Must be unique.
- target chromosome for the specific primers. Must be in line with the chromosome selection critieria.
- sequence The sequence flanking the SNP with the SNP highligted on square brackets (
[]
) and the two alleles separated by a forward slash (/
).
Example:
BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA
SNP list
If the flanking sequence is unknow, but the position on a reference is available, the option --snp_list
can be used and the FASTA file with the reference sequence must be provided with the option --reference
. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs
. The format contains the following positional columns:
- scaffold The sacffold where the SNP is.
- reference allele The base in the reference (may or may not be the same as in the reference file.
- position Position of the SNP. The first base in the scaffold is base 1.
- alternative allele The base in the alternative allele.
- target chromosome for the specific primers. Must be in line with the chromosome selection critieria.
Example
IWGSC_CSS_1AL_scaff_110,C,519,A,2A
This file format can be used with snp_positions_to_polymarker.rb
to produce the input for the option--marker_list
.
Custom reference sequences.
By default, the contigs and pseudomolecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection
is used. The defailt uses ids like: IWGSC_CSS_1AL_scaff_110
, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two
, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file).
If your contigs follow a different convention, in the file ChromosomeArm.rb
it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:
@@arm_selection_functions[:embl] = lambda do | contig_name|
arr = contig_name.split('_')
ret = "U"
ret = arr[2][0,2] if arr.size >= 3
ret = "3B" if arr.size == 2 and arr[0] == "v443"
ret = arr[0][0,2] if arr.size == 1
return ret
end
The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection
. If you want your parser to be added to the distribution, feel free to fork and make a pull request.
##Using blast
To use blast instead of exonerate, use the following command:
./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa --aligner blast -a arm_selection_first_two
Release Notes
0.9.7
There was some strange issue with the numbering, so bumped to 0.9.7
- Moved the arm selection function for fields in the chromosome name to the
ChromosomeArm
class.
0.8.7
- FEATURE:
polymarker.rb
now also prints the total number of hits found.
0.8.6
- BUGFIX:
priemr3.rb
had a regression when adding the repetitive flag to the@values
array. This lead to the wrong order of the columns in the output and possibly other secondary effects.
0.8.5
- Added the option
--max_hits
topolyamarker.rb
to set a maximum number of bast hits to identify repetitive regions. This adds the columnis_repetitve
to the output. The mask is not calculated in repetitive regions and the primers are designed as non-specific.
0.8.4
- Added script ```tag_stats.rb`` That gets the descriptive statistics for a tag in a bam file for each reference.
ruby tag_stats.rb -b HI.3206.006.Index_2.CS_125RNA_14d_Leaf8.sorted.bam -r /Users/ramirezr/Dropbox/JIC/expVIPMetadatas/RefSeq1.0/Genes/annotation/IWGSCv1.0_UTR_ALL.cdnas.fasta --tag 'NH'
0.8.3
- BUGFIX:
ChromosomeArm.rb
was fixed to conform the module assumptions for the package.
0.8.2
- FEATURE: The functions to select the chromosome arm are now in
lib/bio/PolyploidTools/ChromosomeArm.rb
and the help message is updated automatically with the valid options. - FEATURE: Added option
filter_best
to replicate the original behaviour of selecting the best hit of each chromosome. Still useful for assemblies which still contain synthetic duplications.
0.8.1
- BUGFIX: There was an error which prevented the correct localisation of the SNP in markeres with gaps in the local alignment before the position with the snp.
- FEATURE: PolyMarker now selects the best hit of the target chromosome. This improves the specificity in regions with a recent duplication. The drawback is that if your assembly has artificial repetitions, the primers won't be marked as 'chromosome specific', but as 'chromosome semi-specific '. In a future version this will be addressed.
0.8
- FEATURE:
polymarker.rb
added the flag--aligner blast|exonerate
which lets you pick betweenblast
orexonerate
as the aligner. For blast the default is to have the database with the same name as the--contigs
file. However, it is possible to use a different name vua the option--database
.
0.7.3
- FEATURE:
polymarker.rb
Added to the flag--arm_selection
the optionscaffold
, which now supports a scaffold specific primer. - FEATURE:
snp_position_to_polymarker
Added the option--mutant_list
to prepare files for PolyMarker from files with the following columnsID,Allele_1,position,Allele_1,target_chromosome
.
0.7.2
- FEATURE: Added a flag
min_identity
to set the minimum identity to consider a hit. The default is 90
0.7.1
- BUGFIX: Now the parser for
arm_selection_embl
works with the mixture of contigs and pseudomolecules - DOC: Added documentation on how to use custom references.
0.7.0
- Added flag
genomes_count
for number of genomes, to be used on tetraploids, etc.
0.6.1
- polymarker.rb now validates that all the files exist.
- BUGFIX: A reference was required even when it was not used to generate contigs.
Notes
- BUG: Blocks with NNNs are picked and treated as semi-specific.
- BUG: If the name of the reference have space, the ID is not chopped. ">gene_1 (G12A)" shouls be treated as ">gene_1".
- TODO: Add a parameter file to configure the alignments.
- TODO: Produce primers for products of different sizes. This can probably be done with the primer_3_preferences option, but hasn't been tested.