Probabilistic Transformer

Modelling Ambiguities and Distributions for RNA Folding and Molecule Design

This repository contains the source code to the NeurIPS 2022 paper Probabilistic Transformer: Modelling Ambiguities and Distributions for RNA Folding and Molecule Design

Paper on arXiv

Structure of the repository

configs

Contains the configuration files for our experiments on the Synthetic Sequential Distribution, RNA folding and molecule design task we reported in the paper.

data

Contains training, validation and test data for the RNA folding and molecule design task. We use the processed Guacamol dataset from https://github.com/devalab/molgpt and created the RNA folding data based on the description in the paper.

prob_transformer

Contains the source code of the ProbTransformer, the data handler and the training script train_transformer.py. The train script runs out of the box on a downscaled config and creates an experiments folder in the base directory.

Install conda environment

Please adjust the cuda toolkit version in the environment.yml file to fit your setup.

conda env create -n ptenv -f environment.yml
conda activate ptenv
pip install -e .

Prepare data

RNA data

tar -xf data/rna_data.plk.xz -C data/

Molecule data

Download the Guacamol dataset and extract into data.

unzip data/guacamol2.csv.zip -d data/

Model Checkpoints

Please find checkpoints for the ProbTransformer and the CNN head for RNA folding at:

https://ml.informatik.uni-freiburg.de/research-artifacts/probtransformer/prob_transformer_final.pth
https://ml.informatik.uni-freiburg.de/research-artifacts/probtransformer/cnn_head_final.pth

Use the ProbTransformer for RNA folding

Please use the infer_rna_folding.py script to fold a sequence of nucleotides (ACGU).

python infer_rna_folding.py -s ACGUCCUGUGCGAGCAUGCAUGC

To evaluate the uploaded model checkpoints on the test set TS0 use the evaluate flag.

python infer_rna_folding.py -e

Train a ProbTransformer/Transformer model

on the Synthetic Sequential Distribution Task

python prob_transformer/train_transformer.py -c configs/ssd_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/ssd_transformer.yml

on the RNA folding Task

python prob_transformer/train_transformer.py -c configs/rna_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/rna_transformer.yml

on the Molecule Design Task

python prob_transformer/train_transformer.py -c configs/mol_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/mol_transformer.yml

JoergFranke / ProbTransformer