pTrimmer

Used to trim off the primer sequence from amplicon fastq file

PROGRAM: pTrimmer
VERSION: 1.4.0
PLATFORM: Linux, macOS and Windows
COMPILER: gcc >= 4.8.5
AUTHOR: xiaolong zhang
EMAIL: xiaolongzhang2015@163.com
DATE: 2017-09-21
UPDATE: 2024-01-10
DEPENDENCE

zlib >= 1.2.7

NOTE

The first thing you need to do is confirming the libraries above have been installed.
And the gcc compiler should be available on your server or laptop.
The program could run on a standard dual-core laptops with 8 GB of RAM on windows(win7 or win10), macOS and linux(centos or ubuntu).

New Feature (2024-01-10)

(-z|--gzip) Support for output Gzipped trimmed fastq file
(-i|--info) Allow adding primer information to the comment of the trimmed read
Support truncated fastq file detection
Maximum allowed sequence length could be 1,000,000 (bp)

Description

The program is used to trim off the primer sequence of the target sequencing at both 5'(forward primer) and 3'(reverse complement primer).
Both k-mer indexing algorithm and dynamic programing algorithm were performed to trim off the primer sequences.
The performing of k-mer (seed and extend) algorithm makes it possible to deal with thousands of amplicon primer pairs at the same time.
Compared with other kinds of tools, this program could trim the primer sequence off directly from the fastq file, which could save you a lot of time.
There only have 250 reads in the example fastq file, which result in a higher mismatch ratio. But in the general amplicon data, the program will has a good performance and lower mismatch ratio.

Building

See INSTALL for complete details.

Usage

  Options:
     -h|--help        print help infomation
     -l|--keep        keep the complete reads if failed to locate primer
                      sequence [default: discard the reads]
     -t|--seqtype     [required] the sequencing type [single|pair]
     -a|--ampfile     [required] input amplicon file [.txt]
     -f|--read1       [required] read1 (forward) for fastq file [.fq|.gz]
     -d|--trim1       [required] the trimed read1 of fastq file
     -r|--read2       [optional] read2 (reverse) for fastq file (paired-end seqtype) [.fq|.gz]
     -e|--trim2       [optional] the trimed read2 of fastq file (paired-end seqtype)
     -z|--gzip        [optional] output trimmed fastq file in Gzip format
     -i|--info        [optional] add the primer information for each trimmed read
     -s|--summary     [optional] the trimming information of each amplicon [default: Summary.ampcount]
     -q|--minqual     [optional] the minimum average quality to keep after triming [20]
     -k|--kmer        [optional] the kmer lenght for indexing [8]
     -m|--mismatch    [optional] the maxmum mismatch for primer seq [3]

Option

[-h|--help]

  Print out the help infomation

[-l|--keep]

  Whether keep the original complete reads if failed to locate the 
  primer sequence [default: discard the reads]

[-t|--seqtype]

  The sequencing type of input fastq file, which could be single-end 
  or paired-end [single or pair]

[-a|--ampfile]

  The path to amplicon file with text format.
  There is an example in the "Example" directory, which will give you a guidance
  about how to specify each field of the amplicon file.
  [FIELDS]
        1. forwardprimer: the forward primer sequecne (5') [required]
        2. reverseprimer: the reverse primer sequence (5') [required]
        3. insertlength: the insert length between the primer pair [required]
        4. AuxInfo: the auxiliary information that used to describe 
           the primer pair [optional]
  eg. data_amplicon.txt

[-f|--read1]

  The read1 of the fastq file or gziped fastq file
  eg. data_R1.fq or data_R1.fq.gz

[-d|--trim1]

  The trimmed fastq file of read1
  eg. trim_R1.fq or trim.R1.fq

[-r|--read2]

  The read2 of the fastq file or gziped fastq file (paired-end seqtype)
  eg. data_R2.fq or data_R2.fq.gz

[-e|--trim2]

  The trimmed fastq file of read2 (paired-end seqtype)
  eg. trim_R2.fq or trim.R2.fq

[-z|--gzip]

  Output gzipped trimmed fastq file
  eg. both the format of '-d trim_R1.fq' and '-d trim_R1.fq.gz' are ok when
  the parameter '-z' or '--gzip' is given

[-i|--info]

  Add primer information for each trimmed read on the comment (starts with '+')
  format like:

  @ST-E00142:333:H32V7ALXX:2:1101:12784:1731 1:N:0:NTCGAATC
  AGTAGGTGAAGAGCTCGTACAGGACGACCCCGAAGCTCCAGACGTCTGACTGGCGAGAGAAGA
  + P=342 F=1:18 R=120:140
  JJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

  Field:
    P: primer index in the amplicon file
    F: forward primer index (start:end) on the read sequence
    R: reverse primer index (start:end) on the read sequence

  Note:
    when the primer intersect with the sequence, start may be a negative value,
    and end may be longer than the sequence length

[-s|--summary]

  Record the read number of each amplicon [default: Summary.ampcount]

[-q|--minqual]

  The minimum average quality to keep after triming. The program will automatically
  detect the quality coding(Phrd+33 or Phrd+64) [default: 20]

[-k|--kmer]

  The kmer length for primer indexing, a larger kmer will perform an accurate locating
  to the primer sequence, which also means a lower posibility to find the primer 
  sequence. [8 is recommended]

[-m|--mismatch]

  the maxmum mismatch allowed in the  primer matching [ mismatch <= 3 is recommended]

Input

One amplicon

    forward primer(22bp)                                   reverse primer(20bp)
    ++++++++++++++++++=====================================++++++++++++++++++
    |                 |                                   |                 |
ampstart         insertstart                         insertend            ampend
 (100)              (122)                               (380)              (401)

amplicon_file.txt

#FowrdPrimer<TAB>ReversePrimer<TAB>InsertLength<TAB>AuxInfo
AAAAAAAAAAAAAAAAAAAAAA<TAB>BBBBBBBBBBBBBBBBBBBB<TAB>259<TAB>Amplicon1

Description

The amplicon size is 300bp (401-100+1) in this example
forward primer: 22bp (5'->3': AAAAAAAAAAAAAAAAAAAAAA)
reverse primer: 20bp (5'->3': BBBBBBBBBBBBBBBBBBBB)
InsertLength: insertend - insertstart + 1 (380-122+1)
AuxInfo: the amplicon name or something else

Note

The sequence of both forward and reverse primers should be in the direction of 5' to 3'

The insert length is no necessary to be very accurate, it is only used to determine the two conditions of primer
trimming, however, we suggest that users calculate the insert length according to the position given by the primer-design tools:

(1) read-through condition

Amplicon1:
    #FowrdPrimer<TAB>ReversePrimer<TAB>InsertLength<TAB>AuxInfo
    CCCATACAATTTGATGACATGTGGG<TAB>GCTTCCAGGAGCGATCGT<TAB>38<TAB>FakeAmplicon1

Match Status1:
    NCCATACAATTTGATGACATGTGGGTGGTTGACCTGCTTCAGGACGTTGAACTCTGTTTGCAAACGATCGCTCCTGGAAGCAGATCG
    CCCATACAATTTGATGACATGTGGG                                      ACGATCGCTCCTGGAAGC
            |                                                             | 
        forward primer                                          reverse complement primer


(2) normal condition

Amplicon2:
    #FowrdPrimer<TAB>ReversePrimer<TAB>InsertLength<TAB>AuxInfo
    CCCATACAATTTGATGACATGTGGG<TAB>GGTTAGTTCCAGCCTGAATCA<TAB>282<TAB>FakeAmplicon2

Match Status2:
    NCCATACAATTTGATGACATGTGGGTGGTTGACCTGCTTCAGGACGTTGAACTCTGTTTGCAAACGATCGCTCCTGGAAGCAGATCG
    CCCATACAATTTGATGACATGTGGG
            |
        forward primer

Output

The program will generate 3 files for paired-end:

trim.R1.fq (or trim.R1.fq.gz)
trim.R2.fq (or trim.R2.fq.gz)
Summary.ampcount

or 2 files for single-end:

trim.R1.fq (trim.R1.fq.gz)
Summary.ampcount

Description:

trim.R1.fq and trim.R2.fq are the fastq files after primer trimmed!
The field of "AmpCount" in the Summary.ampcount file indicate the reads belong to the amplicon.

Citation

Please cite the following article if you find the pTrimmer is useful to you:

Zhang, X., Shao, Y., Tian, J. et al. pTrimmer: An efficient tool to trim primers of multiplex deep sequencing data. BMC Bioinformatics 20, 236 (2019). https://doi.org/10.1186/s12859-019-2854-x

DMU-lilab / pTrimmer