################################################################################
AUTHOR: JIALU HU EMAIL: jhu@nwpu.edu.cn
Copyright (C) <2019>
This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.
This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
You should have received a copy of the GNU General Public License along with this program. If not, see http://www.gnu.org/licenses/.
################################################################################
We have geneated binary code for Unix-like, Mac, and Windows users (see in $miteFinder/bin) Normally, it will works on machines with x86_64.
If it doesn't work, you need to compile the source code for your own. ################################################################################
To compile the source code, the latest compilers which supports the standard language C++11, also known as C++0x, is needed. Other older compiler may not support it.
Use the code as the following:
cd $miteFinder
make
Then the binary code "miteFinder" will be generated and moved to $miteFinder/bin. Finished :) ################################################################################
./bin/miteFinder -input ${your_input_file} -output ${your_output_file} -pattern_scoring ./profile/pattern_scoring.txt -threshold 0.5
Warning: Your input file should be in sequences or genomes in fasta format. ################################################################################
The description of the MITE is just like this:
mite|6|4131|4140|4194|4203|t3|4138|m1|ave_score:0.649614 GTTGCTCACCCCTGCTCTTGAGCCTTTGAAACATCTACACCAATTTTTTATTGTTTTCAT CTATCCGTTTAAGTGGATTAAAATGATGTTTTTTAATTTTTTTTTATATTTTTTGGGCCG AAAAAACGGACAGCATTGAAAAAAGCCAAGTTTTATTTAATTTAAGAAAAAATAGTCCAA CCAAATGGTTTAA
The 6 means the serial number of chromosome and 4131,4140,4194,4203 is the position of TIR. t3 means the length of TSD is 3. m1 means the TIR is the imperfect inverted repeats and 4138 is the mismatch base. The ave_score:0.649614 is the score of MITE sequence(The more details can be seen in the below citation). ################################################################################
Hu J, Zheng Y, Shang X. MiteFinderII: a novel tool to identify miniature inverted-repeat transposable elements hidden in eukaryotic genomes. BMC medical genomics. 2018 Nov;11(5):51-9. https://doi.org/10.1186/s12920-018-0418-y
################################################################################
THANKS FOR READING
If you have any questions regarding to the program, please don't hesitate to contact us through email.