michaelbarton / genomer-plugin-view

About

View is a plugin for the genomer tool for genome projects. This plugin can be used to generate the files required to upload a genome project. The files generated includes sequence and annotation files. Each of the possible file formats is documented with a manual page.

Usage

The following examples are taken from the Pseudomonas fluorescens R124 genome project. These examples can be run by downloading this project and running bundle install.

The following command can be used to generate a fasta file with associated metadata:

genomer view fasta                                 \
  --identifier='PRJNA68653'                        \
  --organism='Pseudomonas fluorescens'             \
  --strain='R124'                                  \
  --gcode='11'                                     \
  --topology='circular'                            \
  --isolation-source='Orthoquartzite Cave Surface' \
  --collection-date='17-Oct-2007'                  \
  --completeness='Complete'                        \

>PRJNA68653 [organism=Pseudomonas fluorescens] [strain=R124] [gcode=11] ...
TGTTACCTGGTTCGTCCACAACGGGCCGGAATGGCCCCCGTTTTAAGAGACCGGGGATTCTAGAGAAAGC
AAGCCTTCAGGTCAATTTCCAACCAACGTTTCCTTATAAATAGATATCTGGAGCATCCAGAACCAAGACC
TTGCCTGCCAAACATAAAAATAAAGAAGGGAATTATTTAAAGCTTTTCTGTAAAGCTTATAAAAGCTAGG
GCGACAGTCTCTGTGGATAACCATGTTCAGCCCTTGTCTGGCTTGATGTACAGAGAATGACAACTACAGT
GGAAAACCGTGGTCAGCCTGTGCTGCGCTGTCGGATAACCTGTGTGTGGAACCGTCAGTTATCCACAGGC
AGGTTATCCACCGAGTTCCACCCCCAGTTGTCCAGTGCCCTCAGAGGCGGTTATCCACAGAGCTTATTCA
CACACCGTTGGTCGCCTTTTTACCGGTTAACGCATTGATTAATCATGGTCACCACACAACCTGCATGTGG
...

The following can be used to generate an annotation table suitable for submission to GenBank using tbl2asn.

genomer view table					                      \
  --identifier=PRJNA68653                         \
  --reset_locus_numbering=52                      \
  --prefix='I1A_'                                 \
  --generate_encoded_features='gnl|BartonUAkron|' \

>Feature	PRJNA68653	annotation_table
562	2076	gene
      locus_tag	I1A_000052
      gene	dnaA
562	2076	CDS
      protein_id	gnl|BartonUAkron|I1A_000052
      product	DnaA
      function	chromosomal replication initiator protein
2116	3219	gene
      locus_tag	I1A_000053
2116	3219	CDS
      protein_id	gnl|BartonUAkron|I1A_000053
      product	DNA polymerase III, beta subunit
...

Installation

Add this line to your genomer projects's Gemfile:

gem 'genomer-plugin-view'

And then execute in the project directory:

$ bundle

Run the help command and the summary plugin should be available:

$ genomer help
$ genomer man view

Copyright

Genomer copyright (c) 2010 by Michael Barton. Genomer is licensed under the MIT license. See LICENSE.txt for further details. The Star of Bethlehem image is used under a Creative Commons Generic 2.0 Licence. The original can be found on flickr.