We present HRIBO (High-throughput annotation by Ribo-seq), a workflow to enable reproducible and high-throughput analysis of bacterial Ribo-seq data. The workflow performs all required pre-processing steps and quality control. Importantly, HRIBO outputs annotation-independent ORF predictions based on two complementary prokaryotic-focused tools, and integrates them with additional computed features. This facilitates both the rapid discovery of ORFs and their prioritization for functional characterization.
RickGelhausen opened this issue · comments
This is the adapter sequence I trim for "SL":
RIBO_PRO_NEB_R1="CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
For "V" it's just the normal Illumina sequence:
ILLUMINA_TRUSEQ_LT_HT_R1="AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"