Empty result with using Pacbio HiFi reads
Axolotl233 opened this issue · comments
Hi,
Recently I tested nextdenovo v2.4.0 with Fragaria x ananassa hifi reads from NCBI sra database (https://www.ncbi.nlm.nih.gov/sra/SRR11606867). the program end with empty result but no error was reported to STDERR and logfile.
i checked work directory and found the out put file cns.filt.dovt.ovl and cns.filt.dovt.ovl.blof 02.cns_align.sh.work/cns_align* were empty, so i think this is primary reason may be caused empty result in final.
Also, i have complete assembly using Hifiasm with same data, so i think error not caused by incorrect reads type.
my configfile is described below and log file was upload in appendix. please tell me what's wrong and how should i do to solve it, thank you~
[General]
job_type = local
job_prefix = nextDenovo
task = all # 'all', 'correct', 'assemble'
rewrite = yes # yes/no
deltmp = yes
rerun = 10
parallel_jobs = 4
input_type = raw
read_type = hifi
input_fofn = ./input.fofn
workdir = ./01.assembly
[correct_option]
read_cutoff = 5k
genome_size = 830m
seed_depth = 30
pa_correction = 8
sort_options = -m 5g -t 10
minimap2_options_raw = -t 10
correction_options = -p 10
[assemble_option]
minimap2_options_cns = -t 10
nextgraph_options = -a 1
Hi, could you paste the content of file /data/01/user112/project/z.other/AssembleTest/Hifi_test/nextdenovo/01.assembly/02.cns_align/02.cns_align.sh.work/cns_align00/nextDenovo.sh.e to here? I wonder why its result is empty?
Hi, The file you need has been uploaded in appendix.please check it
It seems the input file does not contain any valid sequences, so could you check the output and log files for subjob /data/01/user112/project/z.other/AssembleTest/Hifi_test/nextdenovo/01.assembly/02.cns_align/01.split_seed.sh.work/split_seed0/nextDenovo.sh
My input is fastq format, and output of /data/01/user112/project/z.other/AssembleTest/Hifi_test/nextdenovo/01.assembly/02.cns_align/01.split_seed.sh.work/split_seed0/nextDenovo.sh
like below:
>8 1546896 1.000000 pid=9D5:@.RKSKZZe6if@t\ZW_b9f\IbYM\Il,f\Xz_EV9kUgIMR1tiA\shSKMU^O1wm\UA+)=]V9kfeTB-GYWO8WGFPVW+]UBUDbUUuYZhOzNsgcd[W$^D@5AQ[iXfHohREM5;YQV;yNMSMfNQ> @SRR11606867.1.1730 1730 length=21991ATGTTTGAGGAATATACAGCATGATCTAGTTAATCATTGCCCGATGTCACATTTGAAGACATGTTAAAGAGCATTGACATACTAAGTTATTGAAACTTCTATGATTAGTAAAAATCAGGAAGAGCCTTATGATT
it seems abnormal, i will transformat it to fasta and rerun it again, hope this can solve problem.
Hi, when i trans format fastq of original reads to fasta , the program worked normally and got results.
so i think thats a small bug when split input, fastq format of hifi reads can not be recognized correctly because it not go through correct step.
Yes, I will fix it in next release.