FASTA output is incorrect if there are "N"s in the sequence

Question

FASTA output is incorrect if there are "N"s in the sequence

stuckyb opened this issue 11 years ago · comments

Hello,

First, thanks so much for developing such a useful software product and making it free and open source!

I've noticed a bug when exporting sequence data in FASTA format. If there are any "N"s in the sequence, they evidently do not get counted correctly when Mesquite determines where to break lines in the FASTA file. The line ends up being too long by how ever many "N" characters were encountered. These two lines are example output that illustrates the problem.

CCTGCAGGAGGAGGAGACCCAATTTTATACCAACACCTATTTTGATTTTT
TGNNNNNNNNNNNANTAATTTCTCATATTATTAGCCAAGAATCAGGTAAAAAGGAAACTTTT

I am using Mesquite 2.75.

Thanks!

Daisie Huang · Answer 1 · Thu Feb 13 2014 04:08:05 GMT+0800 (China Standard Time)

Thanks for the bug report! I will look into this hopefully next week.

Daisie Huang · Answer 2 · Tue Feb 25 2014 12:20:59 GMT+0800 (China Standard Time)

I think this is fixed; I went ahead and merged the change because it seems like a pretty small fix that shouldn't affect anything else.